shRNA Lentivirus (self-inactivating), pU6-(Hexim1-shRNA-Seq1)(CAT#: LV-SI2280WQ)
This product is a Hexim1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Expression of Hexim1 gene is induced by hexamethylene-bis-acetamide in vascular smooth muscle cells. The expression of Hexim1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Hexim1-shRNA-Seq1 |
| Related Target/Protein | Hexim1 |
| Region | 3UTR |
| TargetSeq | GCCAAGATAAACTTGTGAGAA |
| NCBI RefSeq | NM_138753 |
| Alternative Names | CLP1; EDG1; HIS1; MAQ1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Viral infection |
