shRNA Lentivirus (self-inactivating), pU6-(LIMS2-shRNA-Seq2)(CAT#: LV-SI0150WQ)
This product is a LIMS2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. LIMS2 gene encodes a member of a small family of focal adhesion proteins which interacts with ILK (integrin-linked kinase), a protein which effects protein-protein interactions with the extraceullar matrix. The expression of LIMS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | LIMS2-shRNA-Seq2 |
| Related Target/Protein | LIMS2 |
| Region | 3UTR |
| TargetSeq | CCTCCCTTTCTCTTTCCTCAT |
| NCBI RefSeq | NM_017980 |
| Alternative Names | LGMD2W; PINCH2; MDRCMTT; PINCH-2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Muscular dystrophy, severe cardiomyopathy and triangular tongues |