shRNA Lentivirus (self-inactivating), pU6-(LOC286238-shRNA-Seq1)(CAT#: LV-SI0081WQ)
This product is a LOC286238-shRNA encoding Lentivirus, which is based on HIV-1 serotype. LOC286238 is an RNA Gene, and is affiliated with the ncRNA class. The expression of LOC286238-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | LOC286238-shRNA-Seq1 |
Related Target/Protein | LOC286238 |
Region | CDS |
TargetSeq | CAGCAAGGAATAGCAGTGAAA |
NCBI RefSeq | XM_379684 |
Titer | >1*10^10 GC/mL |
Related Diseases | Cardiovascular disease (CVD) |