shRNA Lentivirus (self-inactivating), pU6-(Mepe-shRNA-Seq1)(CAT#: LV-SI2304WQ)
This product is a Mepe-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Mepe gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. The expression of Mepe-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Mepe-shRNA-Seq1 |
| Related Target/Protein | Mepe |
| Region | CDS |
| TargetSeq | GCTCCAGCAAAGCTGAAGTTA |
| NCBI RefSeq | NM_053172 |
| Alternative Names | OF45 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Aging-related trabecular bone loss |