shRNA Lentivirus (self-inactivating), pU6-(OR52I1-shRNA-Seq5)(CAT#: LV-SI1667WQ)

This product is a OR52I1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR52I1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR52I1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR52I1-shRNA-Seq5
Related Target/Protein OR52I1
Region CDS
TargetSeq CCTTCATTGCTGCCTCCTATA
NCBI RefSeq XM_372348
Alternative Names OR11-13
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 390037
Uniprot ID Q8NGK6

Related Products