shRNA Lentivirus (self-inactivating), pU6-(PGBD4-shRNA-Seq2)(CAT#: LV-SI0090WQ)
This product is a PGBD4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PGBD4 encoded protein is piggyBac family of proteins. The PiggyBac (PB) transposon is a mobile genetic element that efficiently transposes between vectors and chromosomes via a "cut and paste" mechanism. During transposition, the PB transposase recognizes transposon-specific inverted terminal repeat sequences (ITRs) located on both ends of the transposon vector and efficiently moves the contents from the original sites and efficiently integrates them into TTAA chromosomal sites. The expression of PGBD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | PGBD4-shRNA-Seq2 |
Related Target/Protein | PGBD4 |
Region | CDS |
TargetSeq | GAACAGTTGTTGGCTGAAGAT |
NCBI RefSeq | NM_152595 |
Titer | >1*10^10 GC/mL |
Related Diseases | Parkinson disease (PD) |