shRNA Lentivirus (self-inactivating), pU6-(TTC1-shRNA-Seq2)(CAT#: LV-SI0145WQ)

This product is a TTC1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The TTC1 gene encoded protein plays a role in protein-protein interactions, and binds to the Galpha subunit of G protein-coupled receptors to activate the Ras signaling pathway. The expression of TTC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert TTC1-shRNA-Seq2
Related Target/Protein TTC1
Region 3UTR
TargetSeq CCTGATGTAATGAACCTAATT
NCBI RefSeq NM_003314
Alternative Names TPR1
Titer >1*10^10 GC/mL
Related Diseases Medullary Thyroid Cancer
Target Gene
Gene ID 7265
Uniprot ID Q99614

Related Products