shRNA Lentivirus (self-inactivating), pU6-(TTC21A-shRNA-Seq1)(CAT#: LV-SI0288WQ)
This product is a TTC21A-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Bi-allelic Mutations in TTC21A Induce Asthenoteratospermia in Humans and Mice. The expression of TTC21A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | TTC21A-shRNA-Seq1 |
| Related Target/Protein | TTC21A |
| Region | CDS |
| TargetSeq | GCCGTGATCTTGAATCCTGTA |
| NCBI RefSeq | NM_145755 |
| Alternative Names | STI2; SPGF37; IFT139A |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Asthenoteratospermia |