shRNA Lentivirus (self-inactivating), pU6-(TTC21A-shRNA-Seq1)(CAT#: LV-SI0288WQ)
This product is a TTC21A-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Bi-allelic Mutations in TTC21A Induce Asthenoteratospermia in Humans and Mice. The expression of TTC21A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | TTC21A-shRNA-Seq1 |
Related Target/Protein | TTC21A |
Region | CDS |
TargetSeq | GCCGTGATCTTGAATCCTGTA |
NCBI RefSeq | NM_145755 |
Alternative Names | STI2; SPGF37; IFT139A |
Titer | >1*10^10 GC/mL |
Related Diseases | Asthenoteratospermia |