shRNA Lentivirus (self-inactivating), pU6-(WDR74-shRNA-Seq2)(CAT#: LV-SI0452WQ)
This product is a WDR74-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The WDR74 gene participates in an early cleavage of the pre-rRNA processing pathway in cooperation with NVL and is required for blastocyst formation, is necessary for RNA transcription, processing and/or stability during preimplantation development. The expression of WDR74-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | WDR74-shRNA-Seq2 |
Related Target/Protein | WDR74 |
Region | CDS |
TargetSeq | GACACAGAGACAGATGAACTT |
NCBI RefSeq | NM_018093 |
Alternative Names | Nsa1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Mammary adenocarcinoma |