shRNA Lentivirus (self-inactivating), pH1-(JMJD4-shRNA-Seq2)(CAT#: LV-SI0616WQ)
This product is a JMJD4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. JMJD proteins are mostly epigenetic regulators that demethylate histones. The expression of JMJD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | JMJD4-shRNA-Seq2 |
Related Target/Protein | JMJD4 |
Region | 3UTR |
TargetSeq | GAATCCCATCTGCTGCTGAAT |
NCBI RefSeq | NM_023007 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |