shRNA Adeno-associated Virus Serotype 2, p7SK-(CCDC116-shRNA-Seq2)(CAT#: AAV-SI1109WQ)
This product is a CCDC116-shRNA encoding AAV, which is based on AAV-2 serotype. A cis-eQTL genetic variant of the cancer-testis gene CCDC116 is associated with risk of multiple cancers. The expression of CCDC116-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | CCDC116-shRNA-Seq2 |
Related Target/Protein | CCDC116 |
Region | CDS |
TargetSeq | GTTCAAGGATGAAGACCAGGA |
NCBI RefSeq | NM_152612 |
Titer | >1*10^10 GC/mL |
Related Diseases | colorectal cancer, breast cancer, esophageal cancer, gastric cancer |