shRNA Adeno-associated Virus Serotype 2, p7SK-(KLHL7-shRNA-Seq2)(CAT#: AAV-SI1065WQ)
This product is a KLHL7-shRNA encoding AAV, which is based on AAV-2 serotype. The KLHL7 encoded protein may be involved in protein degradation. Mutations in this gene have been associated with retinitis pigmentosa 42. The expression of KLHL7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | KLHL7-shRNA-Seq2 |
| Related Target/Protein | KLHL7 |
| Region | CDS |
| TargetSeq | GAACTGAAAGCTGGCACACAA |
| NCBI RefSeq | NM_018846 |
| Alternative Names | CISS3; KLHL6; SBBI26 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Retinitis pigmentosa |