shRNA Adeno-associated Virus Serotype 2, p7SK-(Mrpl43-shRNA-Seq1)(CAT#: AAV-SI3922WQ)

This product is a Mrpl43-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Mrpl43 gene help in protein synthesis within the mitochondrion. The expression of Mrpl43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Mrpl43-shRNA-Seq1
Related Target/Protein Mrpl43
Region 3UTR
TargetSeq CAGATGAATCTCTGCGTTTAA
NCBI RefSeq NM_053164
Alternative Names L43mt; MRP-L43; bMRP36a
Titer >1*10^10 GC/mL
Target Gene
Gene ID 84545
Uniprot ID Q8N983

Related Products