shRNA Adeno-associated Virus Serotype 2, pU6-(Tmem26-shRNA-Seq1)(CAT#: AAV-SI2212WQ)
This product is a Tmem26-shRNA encoding AAV, which is based on AAV-2 serotype. The Tmem26 gene encodes a protein containing multiple transmembrane helices. It is a selective surface protein marker of brite/beige adipocytes, which may coexist with classical brown adipocytes in brown adipose tissue. The expression of Tmem26-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Tmem26-shRNA-Seq1 |
| Related Target/Protein | Tmem26 |
| Region | CDS |
| TargetSeq | CAGAGGCTTTGTCGACAATTT |
| NCBI RefSeq | NM_177794 |
| Titer | >1*10^10 GC/mL |