shRNA Adeno-associated Virus Serotype 2, pU6-(Tmem26-shRNA-Seq1)(CAT#: AAV-SI2212WQ)
This product is a Tmem26-shRNA encoding AAV, which is based on AAV-2 serotype. The Tmem26 gene encodes a protein containing multiple transmembrane helices. It is a selective surface protein marker of brite/beige adipocytes, which may coexist with classical brown adipocytes in brown adipose tissue. The expression of Tmem26-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Tmem26-shRNA-Seq1 |
Related Target/Protein | Tmem26 |
Region | CDS |
TargetSeq | CAGAGGCTTTGTCGACAATTT |
NCBI RefSeq | NM_177794 |
Titer | >1*10^10 GC/mL |