shRNA Adeno-associated Virus Serotype 2, p7SK-(Scg2-shRNA-Seq1)(CAT#: AAV-SI3972WQ)

This product is a Scg2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Scg2 gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins and is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The expression of Scg2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Scg2-shRNA-Seq1
Related Target/Protein Scg2
Region CDS
TargetSeq CCCTTGATTCTCAGTCTATTT
NCBI RefSeq NM_009129
Alternative Names SN; CHGC; EM66; SgII
Titer >1*10^10 GC/mL
Related Diseases Nervous system disease
Target Gene
Gene ID 7857
Uniprot ID P13521

Related Products