shRNA Adeno-associated Virus Serotype 2, pU6-(Hemgn-shRNA-Seq1)(CAT#: AAV-SI2278WQ)

This product is a Hemgn-shRNA encoding AAV, which is based on AAV-2 serotype. The Hemgn gene may regulate the proliferation and differentiation of hematopoietic cells. The expression of Hemgn-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Hemgn-shRNA-Seq1
Related Target/Protein Hemgn
Region CDS
TargetSeq CAAGAAGCAGTTGAACCTGAA
NCBI RefSeq NM_053149
Alternative Names NDR; EDAG; CT155; EDAG-1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55363
Uniprot ID Q9BXL5

Related Products