shRNA Adeno-associated Virus Serotype 2, p7SK-(Trmt1-shRNA-Seq3)(CAT#: AAV-SI3705WQ)

This product is a Trmt1-shRNA encoding AAV, which is based on AAV-2 serotype. The Trmt1 gene encodes a tRNA-modifying enzyme that acts as a dimethyltransferase, modifying a single guanine residue at position 26 of the tRNA. The expression of Trmt1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Trmt1-shRNA-Seq3
Related Target/Protein Trmt1
Region CDS
TargetSeq GTAGAGCTTATGCACAGAAAT
NCBI RefSeq NM_198020
Alternative Names TRM1; MRT68
Titer >1*10^10 GC/mL
Related Diseases Autosomal recessive intellectual disorder (ARID)
Target Gene
Gene ID 55621
Uniprot ID O75648

Related Products