shRNA Adeno-associated Virus Serotype 2, pH1-(BOD1-shRNA-Seq2)(CAT#: AAV-SI0686WQ)

This product is a BOD1-shRNA encoding AAV, which is based on AAV-2 serotype. The BOD1 gene is required for proper chromosome biorientation through the detection or correction of syntelic attachments in mitotic spindles. The expression of BOD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert BOD1-shRNA-Seq2
Related Target/Protein BOD1
Region 3UTR
TargetSeq CCAGTTTCCTTTCCTTTGTAA
NCBI RefSeq NM_138369
Alternative Names FAM44B
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 91272
Uniprot ID Q96IK1

Related Products