shRNA Adeno-associated Virus Serotype 2, pH1-(C1QL4-shRNA-Seq2)(CAT#: AAV-SI0936WQ)
This product is a C1QL4-shRNA encoding AAV, which is based on AAV-2 serotype. The C1QL4 gene may regulate the number of excitatory synapses that are formed on hippocampus neurons. The expression of C1QL4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C1QL4-shRNA-Seq2 |
| Related Target/Protein | C1QL4 |
| Region | CDS |
| TargetSeq | CTTCTCCGGCTTCATCATCTA |
| NCBI RefSeq | NM_001008223 |
| Alternative Names | CTRP11; C1QTNF11 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Coronary artery disease |
