shRNA Adeno-associated Virus Serotype 2, pH1-(D730001G18Rik-shRNA-Seq1)(CAT#: AAV-SI3199WQ)
This product is a D730001G18Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by D730001G18Rik has acetylcholine receptor inhibitor activity. The expression of D730001G18Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | D730001G18Rik-shRNA-Seq1 |
Related Target/Protein | D730001G18Rik |
Region | CDS |
TargetSeq | CCTCTATGAGACCTTCAGAGT |
NCBI RefSeq | NM_172433 |
Alternative Names | Ly6g6g |
Titer | >1*10^10 GC/mL |
Target Gene | |
---|---|
Gene ID | 78725 |
Uniprot ID | A0A087WQU7 |