shRNA Adeno-associated Virus Serotype 2, pU6-(ANKS6-shRNA-Seq4)(CAT#: AAV-SI1903WQ)
This product is a ANKS6-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by ANKS6 gene may play a role in renal and cardiovascular development. Mutations in this gene have been shown to cause a form of nephronophthisis (NPHP16), a chronic tubulo-interstitial nephritis. The expression of ANKS6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | ANKS6-shRNA-Seq4 |
| Related Target/Protein | ANKS6 |
| Region | CDS |
| TargetSeq | CTCCATCTGGAACTTCCACTA |
| NCBI RefSeq | NM_173551 |
| Alternative Names | PKDR1; SAMD6; NPHP16; ANKRD14 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Nephronophthisis |