shRNA Adeno-associated Virus Serotype 2, pH1-(FAM36A-shRNA-Seq1)(CAT#: AAV-SI0999WQ)
This product is a FAM36A-shRNA encoding AAV, which is based on AAV-2 serotype. The FAM36A gene encodes a protein that plays a role in the assembly of cytochrome C oxidase, an important component of the respiratory pathway. The expression of FAM36A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | FAM36A-shRNA-Seq1 |
Related Target/Protein | FAM36A |
Region | CDS |
TargetSeq | CTTTGGGATGCTGGTTTCATT |
NCBI RefSeq | NM_198076 |
Alternative Names | COX20 |
Titer | >1*10^10 GC/mL |
Related Diseases | Mitochondrial complex IV deficiency |