shRNA Adeno-associated Virus Serotype 2, pH1-(DPY19L4-shRNA-Seq5)(CAT#: AAV-SI3042WQ)
This product is a DPY19L4-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by DPY19L4 gene is probable C-mannosyltransferase that mediates C-mannosylation of tryptophan residues on target proteins. The expression of DPY19L4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | DPY19L4-shRNA-Seq5 |
| Related Target/Protein | DPY19L4 |
| Region | CDS |
| TargetSeq | CTGCACTTACAGGCTATTTAA |
| NCBI RefSeq | NM_181787 |
| Titer | >1*10^10 GC/mL |