shRNA Adeno-associated Virus Serotype 2, pH1-(GOLGA3-shRNA-Seq1)(CAT#: AAV-SI2705WQ)

This product is a GOLGA3-shRNA encoding AAV, which is based on AAV-2 serotype. The GOLGA3 gene participates in glycosylation and transport of proteins and lipids in the secretory pathway. The expression of GOLGA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert GOLGA3-shRNA-Seq1
Related Target/Protein GOLGA3
Region 3UTR
TargetSeq CCAGAGTTACTTCAGTGCATA
NCBI RefSeq NM_005895
Alternative Names MEA-2; GCP170
Titer >1*10^10 GC/mL
Target Gene
Gene ID 2802
Uniprot ID Q08378

Related Products