shRNA Adeno-associated Virus Serotype 2, pU6-(GEMIN8-shRNA-Seq1)(CAT#: AAV-SI0169WQ)
This product is a GEMIN8-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by GEMIN8 gene is part of the SMN complex, which is necessary for spliceosomal snRNP assembly in the cytoplasm and pre-mRNA splicing in the nucleus. The expression of GEMIN8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | GEMIN8-shRNA-Seq1 |
| Related Target/Protein | GEMIN8 |
| Region | CDS |
| TargetSeq | GAGTCAGATGCAGAGGTAGAA |
| NCBI RefSeq | NM_017856 |
| Alternative Names | FAM51A1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Survival motor neuron (SMN) |
