shRNA Adeno-associated Virus Serotype 2, pH1-(OR2V2-shRNA-Seq2)(CAT#: AAV-SI2495WQ)

This product is a OR2V2-shRNA encoding AAV, which is based on AAV-2 serotype. The OR2V2 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR2V2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert OR2V2-shRNA-Seq2
Related Target/Protein OR2V2
Region CDS
TargetSeq CCTGTTTGAGAAGGTGATATT
NCBI RefSeq XM_210637
Alternative Names OR2V3; OST713
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 285659
Uniprot ID Q96R30

Related Products