shRNA Adeno-associated Virus Serotype 2, pH1-(OR2V2-shRNA-Seq2)(CAT#: AAV-SI2495WQ)
This product is a OR2V2-shRNA encoding AAV, which is based on AAV-2 serotype. The OR2V2 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR2V2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | OR2V2-shRNA-Seq2 |
Related Target/Protein | OR2V2 |
Region | CDS |
TargetSeq | CCTGTTTGAGAAGGTGATATT |
NCBI RefSeq | XM_210637 |
Alternative Names | OR2V3; OST713 |
Titer | >1*10^10 GC/mL |
Related Diseases | Olfactory dysfunction |