shRNA Adeno-associated Virus Serotype 2, pU6-(Cma2-shRNA-Seq1)(CAT#: AAV-SI2220WQ)
This product is a Cma2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Zcchc5 gene has serine-type endopeptidase activity. The expression of Cma2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Cma2-shRNA-Seq1 |
| Related Target/Protein | Cma2 |
| Region | 3UTR |
| TargetSeq | CATCAGAGTCTTCAAGCCAGA |
| NCBI RefSeq | NM_001024714 |
| Alternative Names | Mcp10 |
| Titer | >1*10^10 GC/mL |
| Target Gene | |
|---|---|
| Gene ID | 545055 |
| Uniprot ID | A0A2I3BR33 |