shRNA Adeno-associated Virus Serotype 2, pH1-(XIRP1-shRNA-Seq1)(CAT#: AAV-SI2413WQ)
This product is a XIRP1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by XIRP1 gene is a striated muscle protein and belongs to the Xin actin-binding repeat-containing protein (XIRP) family. The protein functions to protect actin filaments during depolymerization. The expression of XIRP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | XIRP1-shRNA-Seq1 |
| Related Target/Protein | XIRP1 |
| Region | CDS |
| TargetSeq | GAGTCAAGTCAAGATCAGAAA |
| NCBI RefSeq | NM_194293 |
| Alternative Names | Xin; CMYA1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cardiovascular disease |