shRNA Adeno-associated Virus Serotype 2, pU6-(C15orf57-shRNA-Seq3)(CAT#: AAV-SI0316WQ)
This product is a C15orf57-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C15orf57-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C15orf57-shRNA-Seq3 |
| Related Target/Protein | C15orf57 |
| Region | 3UTR |
| TargetSeq | GCTGGGCTTCTTTCTCTCATT |
| NCBI RefSeq | NM_052849 |
| Alternative Names | CCDC32 |
| Titer | >1*10^10 GC/mL |
