shRNA Adeno-associated Virus Serotype 2, pU6-(GOLGA3-shRNA-Seq1)(CAT#: AAV-SI1855WQ)
This product is a GOLGA3-shRNA encoding AAV, which is based on AAV-2 serotype. The GOLGA3 gene participates in glycosylation and transport of proteins and lipids in the secretory pathway. The expression of GOLGA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | GOLGA3-shRNA-Seq1 |
| Related Target/Protein | GOLGA3 |
| Region | 3UTR |
| TargetSeq | CCAGAGTTACTTCAGTGCATA |
| NCBI RefSeq | NM_005895 |
| Alternative Names | MEA-2; GCP170 |
| Titer | >1*10^10 GC/mL |