shRNA Adeno-associated Virus Serotype 2, pH1-(C3orf52-shRNA-Seq1)(CAT#: AAV-SI0772WQ)
This product is a C3orf52-shRNA encoding AAV, which is based on AAV-2 serotype. The C3orf52 encoded protein is a TPA-induced transmembrane protein. The expression of C3orf52-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C3orf52-shRNA-Seq1 |
| Related Target/Protein | C3orf52 |
| Region | CDS |
| TargetSeq | GCTTATGTCTTGCTGCAGTAA |
| NCBI RefSeq | NM_024616 |
| Alternative Names | TTMP |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |