shRNA Adeno-associated Virus Serotype 2, pU6-(KCTD2-shRNA-Seq1)(CAT#: AAV-SI0416WQ)

Datasheet

This product is a KCTD2-shRNA encoding AAV, which is based on AAV-2 serotype. KCTD2, an adaptor of Cullin3 E3 ubiquitin ligase, suppresses gliomagenesis by destabilizing c-Myc. The expression of KCTD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert KCTD2-shRNA-Seq1
Related Target/Protein KCTD2
Region CDS
TargetSeq CCTACTTTGGTCCTATCCTCA
NCBI RefSeq NM_015353
Titer >1*10^10 GC/mL
Related Diseases Ischaemic Stroke and Alzheimer's Disease
Target Gene
Gene ID 23510
Uniprot ID Q14681

Related Products

shRNA Adeno-associated Virus Serotype 2, p7SK-(C20orf43-shRNA-Seq1) (CAT#:AAV-SI1361WQ) AAV PHP.B-Slc6a3p (MCS-EGFP-3Flag)-SV40 PolyA (CAT#:AAV-GTK0668WQ) shRNA Adeno-associated Virus Serotype 2, p7SK-(Fchsd1-shRNA-Seq5) (CAT#:AAV-SI3587WQ) Recombinant adeno-associated virus type 9, pU6-(Human NELL1), Overexpression (CAT#:AAV-GTOH0974WQ) Recombinant adeno-associated virus type 2, pU6-(Human LIN28), Overexpression (CAT#:AAV-GTOH0164WQ) Recombinant adeno-associated virus type 2, pU6-(Human hsa-miR-514b-3p), Overexpression (CAT#:AAV-GTOH0503WQ) shRNA Adeno-associated Virus Serotype 2, pH1-(Prap1-shRNA-Seq1) (CAT#:AAV-SI3141WQ) shRNA Adeno-associated Virus Serotype 2, pH1-(Sash3-shRNA-Seq1) (CAT#:AAV-SI3096WQ)