shRNA Adeno-associated Virus Serotype 2, pU6-(Pomp-shRNA-Seq3)(CAT#: AAV-SI1727WQ)
This product is a Pomp-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Pomp gene is a molecular chaperone that binds 20S preproteasome components and is essential for 20S proteasome formation. The expression of Pomp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Pomp-shRNA-Seq3 |
| Related Target/Protein | Pomp |
| Region | 3UTR |
| TargetSeq | GCAGTAAAGTACAGAGAGGAT |
| NCBI RefSeq | NM_025624 |
| Alternative Names | UMP1; PRAAS2; HSPC014; C13orf12; PNAS-110 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | KLICK syndrome |
