shRNA Adeno-associated Virus Serotype 2, p7SK-(GAGE4-shRNA-Seq2)(CAT#: AAV-SI1450WQ)
This product is a GAGE4-shRNA encoding AAV, which is based on AAV-2 serotype. The GAGE4 gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The expression of GAGE4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | GAGE4-shRNA-Seq2 |
Related Target/Protein | GAGE4 |
Region | CDS |
TargetSeq | GTACAGCCTCCTGAAATGATT |
NCBI RefSeq | NM_001474 |
Alternative Names | CT4.4 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast Cancer |