shRNA Adeno-associated Virus Serotype 2, pU6-(PRM2-shRNA-Seq1)(CAT#: AAV-SI0395WQ)
This product is a PRM2-shRNA encoding AAV, which is based on AAV-2 serotype. The PRM2 gene encodes protamine 2, which is cleaved to give rise to a family of protamine 2 peptides. The expression of PRM2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | PRM2-shRNA-Seq1 |
| Related Target/Protein | PRM2 |
| Region | CDS |
| TargetSeq | GCAGAACCAGGAAGAGAACAT |
| NCBI RefSeq | NM_002762 |
| Alternative Names | CT94.2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Prostate cancer |