shRNA Adeno-associated Virus Serotype 2, p7SK-(TMEM167B-shRNA-Seq1)(CAT#: AAV-SI3204WQ)
This product is a TMEM167B-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by TMEM167B nvolved in the early part of the secretory pathway. The expression of TMEM167B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | TMEM167B-shRNA-Seq1 |
| Related Target/Protein | TMEM167B |
| Region | CDS |
| TargetSeq | GCAATTGCTTGTGTTGTAATG |
| NCBI RefSeq | NM_020141 |
| Alternative Names | AD-020; C1orf119 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Prostate cancer |