shRNA Adeno-associated Virus Serotype 2, pU6-(SLC9A11-shRNA-Seq3)(CAT#: AAV-SI0127WQ)

This product is a SLC9A11-shRNA encoding AAV, which is based on AAV-2 serotype. SLC9A11 is a member of the sodium-hydrogen exchanger (NHE) family and involved in pH regulation. The expression of SLC9A11-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SLC9A11-shRNA-Seq3
Related Target/Protein SLC9A11
Region CDS
TargetSeq GAGGATCGAATACATTCCTTT
NCBI RefSeq NM_178527
Alternative Names SLC9C2
Titer >1*10^10 GC/mL
Related Diseases Endometrial cancer
Target Gene
Gene ID 284525
Uniprot ID Q5TAH2

Related Products