shRNA Adeno-associated Virus Serotype 2, pU6-(TCTN3-shRNA-Seq1)(CAT#: AAV-SI2243WQ)
This product is a TCTN3-shRNA encoding AAV, which is based on AAV-2 serotype. The TCTN3 gene encodes a member of the tectonic gene family which functions in Hedgehog signal transduction and development of the neural tube. Mutations in this gene have been associated with Orofaciodigital Syndrome IV and Joubert Syndrom 18. The expression of TCTN3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | TCTN3-shRNA-Seq1 |
Related Target/Protein | TCTN3 |
Region | CDS |
TargetSeq | CATACCAGTTTCCCTGGAGAT |
NCBI RefSeq | NM_015631 |
Alternative Names | OFD4; TECT3; JBTS18; C10orf61 |
Titer | >1*10^10 GC/mL |
Related Diseases | Orofaciodigital Syndrome IV and Joubert Syndrom 18 |