shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(C3orf37-shRNA-Seq2)(CAT#: AdV-SI1408WQ)

This product is a C3orf37-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C3orf37 gene acts as an enzyme that recognizes and binds abasic sites in ssDNA at replication forks and chemically modifies the lesion by forming a covalent cross-link with DNA. The expression of C3orf37-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C3orf37-shRNA-Seq2
Related Target/Protein C3orf37
Region CDS
TargetSeq GAGGCAGTTTCTAAATGGCTT
NCBI RefSeq NM_020187
Alternative Names DC12; SRAPD1; HMCES
Titer >1*10^10 GC/mL
Related Diseases DNA demethylation
Target Gene
Gene ID 56941
Uniprot ID Q96FZ2

Related Products