shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Fads6-shRNA-Seq1)(CAT#: AdV-SI4018WQ)

This product is a Fads6-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. This protein encoded by Fads6 gene is involved in the pathway fatty acid metabolism, which is part of Lipid metabolism.The expression of Fads6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Fads6-shRNA-Seq1
Related Target/Protein Fads6
Region CDS
TargetSeq CATGAATGTGTCAGGCTTCAA
NCBI RefSeq NM_178035
Alternative Names FP18279
Titer >1*10^10 GC/mL
Target Gene
Gene ID 283985
Uniprot ID Q8N9I5

Related Products