shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Obfc1-shRNA-Seq1)(CAT#: AdV-SI4050WQ)

This product is a Obfc1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Obfc1 gene appears to function in a telomere-associated complex with C17ORF68 and TEN1. The expression of Obfc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Obfc1-shRNA-Seq1
Related Target/Protein Obfc1
Region CDS
TargetSeq GCAGCAGAAGATCTACCACAT
NCBI RefSeq NM_175360
Alternative Names AAF44; OBFC1; AAF-44; RPA-32; bA541N10.2; STN1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 79991
Uniprot ID Q9H668

Related Products