shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(OR2A5-shRNA-Seq4)(CAT#: AdV-SI3258WQ)

This product is a OR2A5-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The OR2A5 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR2A5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert OR2A5-shRNA-Seq4
Related Target/Protein OR2A5
Region CDS
TargetSeq CCCATGAAATCAACCACTTCT
NCBI RefSeq XM_374683
Alternative Names OR2A8; OR2A26; OR2A11P; OR7-138; OR7-141
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 393046
Uniprot ID Q96R48

Related Products