shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(DEPDC1-shRNA-Seq1)(CAT#: AdV-SI0064WQ)
This product is a DEPDC1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The DEPDC1 gene may be involved in transcriptional regulation as a transcriptional corepressor. The expression of DEPDC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | DEPDC1-shRNA-Seq1 |
| Related Target/Protein | DEPDC1 |
| Region | CDS |
| TargetSeq | GAGATGGACTATTTGCTCCTT |
| NCBI RefSeq | NM_017779 |
| Alternative Names | DEP.8; SDP35; DEPDC1A; DEPDC1-V2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Bladder cancer |
