shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Psme4-shRNA-Seq2)(CAT#: AdV-SI3422WQ)
This product is a Psme4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Psme4 gene is associated component of the proteasome that specifically recognizes acetylated histones and promotes ATP- and ubiquitin-independent degradation of core histones during spermatogenesis and DNA damage response. The expression of Psme4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Psme4-shRNA-Seq2 |
Related Target/Protein | Psme4 |
Region | CDS |
TargetSeq | GCACTTCCAAGGATCTCATAA |
NCBI RefSeq | NM_134013 |
Alternative Names | PA200 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |