shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C1orf180-shRNA-Seq3)(CAT#: AdV-SI0885WQ)

This product is a C1orf180-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C1orf180-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C1orf180-shRNA-Seq3
Related Target/Protein C1orf180
Region 3UTR
TargetSeq CCTGCAAGTATCCAGAGAGTT
NCBI RefSeq NM_001033660
Alternative Names LINC01555
Titer >1*10^10 GC/mL
Target Gene
Gene ID 439927
Uniprot ID Q8NAE3

Related Products