shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C4orf41-shRNA-Seq1)(CAT#: AdV-SI0742WQ)
This product is a C4orf41-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by C4orf41 gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. The expression of C4orf41-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | C4orf41-shRNA-Seq1 |
Related Target/Protein | C4orf41 |
Region | CDS |
TargetSeq | GCTGCCATCTCTCAACATCAA |
NCBI RefSeq | NM_021942 |
Alternative Names | GRY; FOIGR; LGMD2S; TRAPPC11; LGMDR18 |
Titer | >1*10^10 GC/mL |