shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CCDC116-shRNA-Seq2)(CAT#: AdV-SI0608WQ)
This product is a CCDC116-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. A cis-eQTL genetic variant of the cancer-testis gene CCDC116 is associated with risk of multiple cancers. The expression of CCDC116-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | CCDC116-shRNA-Seq2 |
| Related Target/Protein | CCDC116 |
| Region | CDS |
| TargetSeq | GTTCAAGGATGAAGACCAGGA |
| NCBI RefSeq | NM_152612 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | colorectal cancer, breast cancer, esophageal cancer, gastric cancer |