shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Iqcf4-shRNA-Seq1)(CAT#: AdV-SI3083WQ)
This product is a Iqcf4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Iqcf4 gene has calmodulin binding ability. The expression of Iqcf4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Iqcf4-shRNA-Seq1 |
| Related Target/Protein | Iqcf4 |
| Region | CDS |
| TargetSeq | GACATAAAGGAAACAAGGAAA |
| NCBI RefSeq | NM_026090 |
| Alternative Names | mtIQ1; 1700042N06Rik |
| Titer | >1*10^10 GC/mL |
