shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Zmynd12-shRNA-Seq2)(CAT#: AdV-SI3516WQ)

This product is a Zmynd12-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Zmynd12-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Zmynd12-shRNA-Seq2
Related Target/Protein Zmynd12
Region CDS
TargetSeq CCCTGATCATTCAAGAATCTA
NCBI RefSeq NM_001014900
Titer >1*10^10 GC/mL
Target Gene
Gene ID 84217
Uniprot ID Q9H0C1

Related Products