shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(KIAA0495-shRNA-Seq1)(CAT#: AdV-SI0926WQ)
This product is a KIAA0495-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of KIAA0495-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | KIAA0495-shRNA-Seq1 |
| Related Target/Protein | KIAA0495 |
| Region | CDS |
| TargetSeq | CAAGTAAAGATACCAGCAGTG |
| NCBI RefSeq | NM_207306 |
| Alternative Names | PDAM; TP73-AS1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Oligodendroglial tumors |
| Target Gene | |
|---|---|
| Gene ID | 57212 |
| Uniprot ID | A0A024R4G0 |